Skip to main content
Addgene

pcDNA3_attR1-ORF-attR2-V2R-NTEV-TCS-GV-2xHA_DEST
(Plasmid #194386)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194386 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    attR1-ORF-attR2-V2R-NTEV-TCS-GV-2xHA
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • 2xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BmgBI (destroyed during cloning)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3_attR1-ORF-attR2-V2R-NTEV-TCS-GV-2xHA_DEST was a gift from Michael Wehr (Addgene plasmid # 194386 ; http://n2t.net/addgene:194386 ; RRID:Addgene_194386)
  • For your References section:

    Improved Split TEV GPCR beta-arrestin-2 Recruitment Assays via Systematic Analysis of Signal Peptide and beta-arrestin Binding Motif Variants. Wu Y, von Hauff IV, Jensen N, Rossner MJ, Wehr MC. Biosensors (Basel). 2022 Dec 29;13(1):48. doi: 10.3390/bios13010048. 10.3390/bios13010048 PubMed 36671883