pGL4_10xUAS-MLPmin-luc2
(Plasmid
#194383)
-
PurposeReporter plasmid for split TEV assays; firefly luciferase reporter gene driven by 10x clustered UAS binding sites linked to a minimal MLP promoter
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGL4
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name10xUAS-luc2
-
SpeciesSynthetic
- Promoter MLP minimal
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4_10xUAS-MLPmin-luc2 was a gift from Michael Wehr (Addgene plasmid # 194383 ; http://n2t.net/addgene:194383 ; RRID:Addgene_194383) -
For your References section:
Improved Split TEV GPCR beta-arrestin-2 Recruitment Assays via Systematic Analysis of Signal Peptide and beta-arrestin Binding Motif Variants. Wu Y, von Hauff IV, Jensen N, Rossner MJ, Wehr MC. Biosensors (Basel). 2022 Dec 29;13(1):48. doi: 10.3390/bios13010048. 10.3390/bios13010048 PubMed 36671883
