pcDNA3_SP-DRD1-V2R-NTEV-TCS-GV-2xHA
(Plasmid
#194361)
-
PurposeSplit TEV assays
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSP-DRD1-V2R-NTEV-TCS-GV-2xHA
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneDRD1 (a.k.a. D1R, DADR, DRD1A)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2xHA (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3_SP-DRD1-V2R-NTEV-TCS-GV-2xHA was a gift from Michael Wehr (Addgene plasmid # 194361 ; http://n2t.net/addgene:194361 ; RRID:Addgene_194361) -
For your References section:
Improved Split TEV GPCR beta-arrestin-2 Recruitment Assays via Systematic Analysis of Signal Peptide and beta-arrestin Binding Motif Variants. Wu Y, von Hauff IV, Jensen N, Rossner MJ, Wehr MC. Biosensors (Basel). 2022 Dec 29;13(1):48. doi: 10.3390/bios13010048. 10.3390/bios13010048 PubMed 36671883