NFfshb-t2a-GFP
(Plasmid
#194356)
-
Purposeover expression vector for killifish fshb tagged with GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8119
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefollicle stimulating hormone beta subunit
-
Alt namefshb
-
SpeciesNothobranchius furzeri
-
Insert Size (bp)351
-
Tag
/ Fusion Protein
- t2a-GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCAACTGGTTGTCATGGCAGC
- 3′ sequencing primer ACAGCCGAGTACGTGTGGATGGAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NFfshb-t2a-GFP was a gift from Itamar Harel (Addgene plasmid # 194356 ; http://n2t.net/addgene:194356 ; RRID:Addgene_194356) -
For your References section:
A scalable and tunable platform for functional interrogation of peptide hormones in fish. Moses E, Franek R, Harel I. eLife. 2023 Oct 24;12:e85960. doi: 10.7554/eLife.85960. 10.7554/eLife.85960 PubMed 37872843