pECNUS_MP01
(Plasmid
#194350)
-
PurposeCRISPR-Cas9 multiplexing acceptor clone with BpiI cutter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAGM4723
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 14307
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepcoCas9, FAST-Red
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)8000
- Promoter RPS5A
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtacaatctgctctgatgccgc
- 3′ sequencing primer gattacatggcaacccaaact (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pECNUS_MP01 is a binary vector, it contains BpiI cutter flanking LacZ, proper for cloning with <= 6 sgRNA expression cassettes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECNUS_MP01 was a gift from Eunyoung Chae (Addgene plasmid # 194350 ; http://n2t.net/addgene:194350 ; RRID:Addgene_194350) -
For your References section:
Generating minimum set of gRNA to cover multiple targets in multiple genomes with MINORg. Lee RR, Cher WY, Wang J, Chen Y, Chae E. Nucleic Acids Res. 2023 Mar 15:gkad142. doi: 10.1093/nar/gkad142. 10.1093/nar/gkad142 PubMed 36919598