pCS2-CIB1-mCherry-Rab8A
(Plasmid #194333)

• Purpose: For use in light-induced Rab8a protein inactivation through the interaction with CRY2
• Depositing Lab: Heidi Hehnly
• Publication: Aljiboury et al PLoS Genet. 2023 May 15;19(5):e1010765. doi: 10.1371/journal.pgen.1010765. eCollection 2023 May.

Backbone

• Vector backbone: pCS2
• Backbone size w/o insert (bp): 4067
• Total vector size (bp): 5960
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: CIB1
• Alt name: cryptochrome-interacting basic-helix-loop-helix 1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 516
• Entrez Gene: CIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
• Promoter: CMV IE94

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Sp6

Gene/Insert 2

• Gene/Insert name: Rab8a
• Species: Canis Lupus
• Insert Size (bp): 621
• Entrez Gene: RAB8A (a.k.a. RAB8)
• Promoter: CMV IE94
• Tag / Fusion Protein:
  • mcherry (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcatggacgagctgtacaa
• 3′ sequencing primer: T3

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry