Skip to main content
Addgene

pSBbi G418R mbIL21
(Plasmid #194329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194329 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBbi
  • Backbone size w/o insert (bp) 5835
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mbIL-21
  • Alt name
    Membrane bound Interleukin-21
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1206
  • Entrez Gene
    IL21 (a.k.a. CVID11, IL-21, Za11)
  • Promoter EF1-a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi G418R mbIL21 was a gift from Alexander McLellan (Addgene plasmid # 194329 ; http://n2t.net/addgene:194329 ; RRID:Addgene_194329)
  • For your References section:

    Sleeping Beauty kit sets provide rapid and accessible generation of artificial antigen-presenting cells for natural killer cell expansion. Dobson LJ, Saunderson SC, Smith-Bell SW, McLellan AD. Immunol Cell Biol. 2023 Aug 16. doi: 10.1111/imcb.12679. 10.1111/imcb.12679 PubMed 37585342