-
PurposeConsitiutive mammalian expression of membrane bound human IL-21
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBbi
- Backbone size w/o insert (bp) 5835
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namembIL-21
-
Alt nameMembrane bound Interleukin-21
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1206
-
Entrez GeneIL21 (a.k.a. CVID11, IL-21, Za11)
- Promoter EF1-a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi G418R mbIL21 was a gift from Alexander McLellan (Addgene plasmid # 194329 ; http://n2t.net/addgene:194329 ; RRID:Addgene_194329) -
For your References section:
Sleeping Beauty kit sets provide rapid and accessible generation of artificial antigen-presenting cells for natural killer cell expansion. Dobson LJ, Saunderson SC, Smith-Bell SW, McLellan AD. Immunol Cell Biol. 2023 Aug 16. doi: 10.1111/imcb.12679. 10.1111/imcb.12679 PubMed 37585342