pSBbi G418R mbIL21
(Plasmid #194329)

• Purpose: Consitiutive mammalian expression of membrane bound human IL-21
• Depositing Lab: Alexander McLellan
• Publication: Dobson et al Immunol Cell Biol. 2023 Aug 16. doi: 10.1111/imcb.12679.

Backbone

• Vector backbone: pSBbi
• Backbone size w/o insert (bp): 5835
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mbIL-21
• Alt name: Membrane bound Interleukin-21
• Species: H. sapiens (human)
• Insert Size (bp): 1206
• Entrez Gene: IL21 (a.k.a. CVID11, IL-21, Za11)
• Promoter: EF1-a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pSBbi G418R mbIL21.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry