pHrD-IRES-Fluc
(Plasmid #194250)

• Purpose: Human RNAP1 promoter region driving firefly luciferase expression from IRES. Constructed by Ghoshal, et al. J Biol Chem (2004). Please cite this original manuscript!
• Depositing Lab: Samson Jacob
• Publication: McCool et al RNA. 2022 Nov 2. pii: rna.079149.122. doi: 10.1261/rna.079149.122.

Backbone

• Vector backbone: pGL3
• Total vector size (bp): 6135
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Promoter: human rDNA promoter and beginning of 5' ETS (-410 to +327 of pre-rRNA transcript)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: GACGATAGTCATGCCCCGCG

Resource Information

• Supplemental Documents:
  • pHrD-IRES-Fluc.gb
• A portion of this plasmid was derived from a plasmid made by: Samson Jacob lab (OSU); manuscript doi: 10.1074/jbc.M309393200
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid was constructed by Samson Jacob lab.

Manuscript citation:
Ghoshal K, Majumder S, Datta J, Motiwala T, Bai S, Sharma SM, Frankel W, Jacob ST. Role of human ribosomal RNA (rRNA) promoter methylation and of methyl-CpG-binding protein MBD2 in the suppression of rRNA gene expression. J Biol Chem. 2004;279(8):6783-93. doi: 10.1074/jbc.M309393200. PubMed PMID: 14610093; PMCID: 2242730.