pAM/CBA-eGFP-miRaSyn(mouse)x3-WPRE-bGHpA
(Plasmid
#194248)
-
PurposeExpresses 3 miRNAs targeting mouse alpha-Synuclein
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAM
- Backbone size w/o insert (bp) 6085
-
Vector typeAAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRaSynuclein(mouse)
-
gRNA/shRNA sequenceGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGATGTCTTCCAGGATTCCTTCCGTTTTGGCCACTGACTGACGGAAGGAACTGGAAGACATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTTCAGGCTCATAGTCTTGGTAGTTTTGGCCACTGACTGACTACCAAGAATGAGCCTGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)420
-
Entrez GeneSnca (a.k.a. NACP, alpha-Syn, alphaSYN)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid contains an 11bp deletion in one of the ITRs. This deletion does not affect plasmid performance as the virus undergoes self-repair of this region during AAV packaging.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM/CBA-eGFP-miRaSyn(mouse)x3-WPRE-bGHpA was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 194248 ; http://n2t.net/addgene:194248 ; RRID:Addgene_194248)
