Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CJ8421_04975 Rptr2 recording plasmid
(Plasmid #194211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194211 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    sc101-KanR-P70a-deGFP
  • Backbone size w/o insert (bp) 4863
  • Total vector size (bp) 4890
  • Modifications to backbone
    Inserting 27bp PAM-flanking DNA target (taagttcaatgtttttacattgAGAAA) in front of OR2-OR1 promoter in the backbone vector.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    One Shot™ TOP10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CJ8421_04975 Rptr2 DNA target
  • Insert Size (bp)
    27

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGGGTGGGCTAACGATATCC
  • 3′ sequencing primer GAACTTCAGGGTCAGCTTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CJ8421_04975 Rptr2 recording plasmid was a gift from Chase Beisel (Addgene plasmid # 194211 ; http://n2t.net/addgene:194211 ; RRID:Addgene_194211)
  • For your References section:

    RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543