Skip to main content
Addgene

Sth1Cas9n cytosine base editor
(Plasmid #194209)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194209 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCBS1489
  • Backbone size w/o insert (bp) 6495
  • Total vector size (bp) 9855
  • Modifications to backbone
    Insert Sth1Cas9-D9A nickase
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MDS™42 Meta LowMut (C-6786-10K, Scarab Genomics, LLC.)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sth1Cas9-D9A nickase
  • Species
    Streptococcus thermophilus
  • Insert Size (bp)
    3360
  • Mutation
    Changed Aspartate 9 to Alanine.
  • GenBank ID
    CP000419.1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagaaatgtcctgagcaatcac
  • 3′ sequencing primer catgcaactcgtaggacaggtg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sth1Cas9n cytosine base editor was a gift from Chase Beisel (Addgene plasmid # 194209 ; http://n2t.net/addgene:194209 ; RRID:Addgene_194209)

  • For your References section:

    RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543
Related items:
Commonly requested with: