Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOxyR_rfp
(Plasmid #194155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA-based
  • Backbone manufacturer
    https://seva-plasmids.com/
  • Backbone size w/o insert (bp) 2754
  • Total vector size (bp) 4511
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositing Lab uses E. coli BL21 (DE3) Gold lacIq1 at 30 C for protein production.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
  • Species
    E. coli
  • Insert Size (bp)
    1757
  • Promoter PoxyR, PoxyS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGAGCGTTCTGAACAAATC
  • 3′ sequencing primer CCCAGTCTTTCGACTGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOxyR_rfp was a gift from Sven Panke (Addgene plasmid # 194155 ; http://n2t.net/addgene:194155 ; RRID:Addgene_194155)
  • For your References section:

    Whole-cell screening of oxidative enzymes using genetically encoded sensors. Kardashliev T, Weingartner A, Romero E, Schwaneberg U, Fraaije M, Panke S, Held M. Chem Sci. 2021 Oct 29;12(44):14766-14772. doi: 10.1039/d1sc02578c. eCollection 2021 Nov 17. 10.1039/d1sc02578c PubMed 34820092