pOxyR_gfp
(Plasmid
#194154)
-
PurposeGreen Fluorescent Reporter of intracellular hydrogen peroxide
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194154 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEVA-based
-
Backbone manufacturerhttps://seva-plasmids.com/
- Backbone size w/o insert (bp) 2390
- Total vector size (bp) 4158
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing Lab uses E. coli BL21 (DE3) Gold lacIq1 at 30 C for protein production.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametranscriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
-
SpeciesE. coli
-
Insert Size (bp)1768
- Promoter PoxyR, PoxyS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGAGCGTTCTGAACAAATC
- 3′ sequencing primer CCCAGTCTTTCGACTGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOxyR_gfp was a gift from Sven Panke (Addgene plasmid # 194154 ; http://n2t.net/addgene:194154 ; RRID:Addgene_194154) -
For your References section:
Whole-cell screening of oxidative enzymes using genetically encoded sensors. Kardashliev T, Weingartner A, Romero E, Schwaneberg U, Fraaije M, Panke S, Held M. Chem Sci. 2021 Oct 29;12(44):14766-14772. doi: 10.1039/d1sc02578c. eCollection 2021 Nov 17. 10.1039/d1sc02578c PubMed 34820092