pYDE007
(Plasmid #194152)

• Purpose: sgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, CarbR. Contains mrfp nontargeting control guide sequence.
• Depositing Lab: Edward Geisinger
• Publication: Bai et al J Bacteriol. 2021 May 20;203(12):e0056520. doi: 10.1128/JB.00565-20. Epub 2021 Mar 29.

Backbone

• Vector backbone: pWH1266
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 8854
• Modifications to backbone: The BamHI-SalI fragment internal to tetA in pWH1266 was replaced with a PCR product having the same restriction sites and J23119, sgRNA, and terminator from pgRNA-bacteria.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Carbenicillin 50 ug/ml can be used
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA with mrfp control guide sequence
• gRNA/shRNA sequence: AACTTTCAGTTTAGCGGTCT
• Promoter: J23119

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: TCAGGCACCGTGTATGAAATC
• 3′ sequencing primer: TCCTACGAGTTGCATGATAAAG

Resource Information

• Supplemental Documents:
  • pYDE007(pWH1266-sgRNA).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry