NcCas9
(Plasmid
#194093)
-
PurposeExpresses human codon optimized NcCas9. Genome editing in human cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3300
- Total vector size (bp) 6765
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNcCas9
-
SpeciesSynthetic
-
Insert Size (bp)3300
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer tagaaggcacagtcgaggctgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNcCas9 synthesized by Genscript Biotech.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NcCas9 was a gift from Zhanjun Li (Addgene plasmid # 194093 ; http://n2t.net/addgene:194093 ; RRID:Addgene_194093) -
For your References section:
Versatile and efficient genome editing with Neisseria cinerea Cas9. Liu Z, Chen S, Xie W, Yu H, Lai L, Li Z. Commun Biol. 2022 Nov 26;5(1):1296. doi: 10.1038/s42003-022-04258-z. 10.1038/s42003-022-04258-z PubMed 36435853