Skip to main content
Addgene

pBB75-ncRNA
(Plasmid #194087)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194087 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBB75

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ec86 ncRNA
  • gRNA/shRNA sequence
    TGATAAGATTCCGTATGCGCACCCTTAGCGAGAGGTTTATCATTAAGGTCAACCTCTGGATGTTGTTTCGGCATCCTGCATTGAATCTGAGTTACTGTCTGTTTTCCTTGTTGGAACGGAGAGCATCGCCTGATGCTCTCCGAGCCAACCAGGAAACCCGTTTTTTCTGACGTAAGGGTGCGCAACTTTC
  • Species
    E. coli
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer T7ter
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBB75-ncRNA was a gift from Tingting Zou (Addgene plasmid # 194087 ; http://n2t.net/addgene:194087 ; RRID:Addgene_194087)

  • For your References section:

    Cryo-EM structures of Escherichia coli Ec86 retron complexes reveal architecture and defence mechanism. Wang Y, Guan Z, Wang C, Nie Y, Chen Y, Qian Z, Cui Y, Xu H, Wang Q, Zhao F, Zhang D, Tao P, Sun M, Yin P, Jin S, Wu S, Zou T. Nat Microbiol. 2022 Sep;7(9):1480-1489. doi: 10.1038/s41564-022-01197-7. Epub 2022 Aug 18. 10.1038/s41564-022-01197-7 PubMed 35982312
Related items:
Commonly requested with: