AID-BFP-loxP_myo2_neoR
(Plasmid
#194054)
-
PurposeDual-selection cassette plasmid for knocking-in AID-BFP into the C. elegans genome
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneloxP_myo2_neoR
-
Backbone manufacturerJohn Calarco's lab at University of Toronto
-
Vector typeWorm Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIAA17
-
Alt nameminimal degron sequence (71-114aa)
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)132
-
Entrez GeneAXR3 (a.k.a. AT1G04250, AUXIN RESISTANT 3, AtIAA17, F19P19.31, F19P19_31, IAA17, indole-3-acetic acid inducible 17)
- Promoter None
-
Tag
/ Fusion Protein
- bfp (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 (-41) Forward
- 3′ sequencing primer pMyo2 ccctcaatgtctctacttgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AID-BFP-loxP_myo2_neoR was a gift from Kota Mizumoto (Addgene plasmid # 194054 ; http://n2t.net/addgene:194054 ; RRID:Addgene_194054) -
For your References section:
Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. Kurashina M, Mizumoto K. STAR Protoc. 2023 Jan 13;4(1):102028. doi: 10.1016/j.xpro.2022.102028. 10.1016/j.xpro.2022.102028 PubMed 36640369