pAAV-U6-sgRNA(CTRL)-CMV-eGFP
(Plasmid #194017)

• Purpose: Expresses a gRNA that targets the LacZ gene (serves as control) and eGFP
• Depositing Lab: Larry Young
• Publication: Boender et al Sci Adv. 2023 Jun 2;9(22):eadf4950. doi: 10.1126/sciadv.adf4950. Epub 2023 May 31.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Hetian Lei #85451
• Backbone size w/o insert (bp): 5163
• Total vector size (bp): 5183
• Modifications to backbone: addition of gRNA
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: sgRNA(CTRL)
• Alt name: sgRNA(LacZ)
• gRNA/shRNA sequence: GTGAGCGAGTAACAACCCGT
• Species: M. musculus (mouse), R. norvegicus (rat); prairie vole, california deer mouse, golden hamster, spiny mouse
• Insert Size (bp): 20
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SapI (destroyed during cloning)
• 3′ cloning site: SapI (destroyed during cloning)
• 5′ sequencing primer: cgcgtgagggcctatttcc
• 3′ sequencing primer: Unknown

Gene/Insert 2

• Gene/Insert name: eGFP
• Alt name: enhanced green fluorescent protein
• gRNA/shRNA sequence: N/A
• Species: Aequorea victoria
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry