Skip to main content
Addgene

p8270 LentiCRISPR v2 hygro sgSIGIRR-3
(Plasmid #193979)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193979 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    plentiCRISPRv2 hygro
  • Backbone manufacturer
    Brett Stringer, Addgene #98291
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9 and sgRNA targeting SIGIRR
  • gRNA/shRNA sequence
    GGGCCCGGGATACCAGCGCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    SIGIRR (a.k.a. IL-1R8, TIR8)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p8270 LentiCRISPR v2 hygro sgSIGIRR-3 was a gift from Elizabeth White (Addgene plasmid # 193979 ; http://n2t.net/addgene:193979 ; RRID:Addgene_193979)

  • For your References section:

    Systematic Analysis of IL-1 Cytokine Signaling Suppression by HPV16 Oncoproteins. Castagnino P, Kim HW, Lam LKM, Basu D, White EA. J Virol. 2022 Nov 7:e0132622. doi: 10.1128/jvi.01326-22. 10.1128/jvi.01326-22 PubMed 36342298
Related items: