GreenT-EC.c - pRSET
(Plasmid
#193949)
-
PurposeBacterial expression vector for a low-affinity calcium indicator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSET-B
- Backbone size w/o insert (bp) 2901
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreenT-EC.c
-
SpeciesBranchiostoma lanceolatum / Opsanus tau
-
Insert Size (bp)1059
-
Tag
/ Fusion Protein
- His-Tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAG
- 3′ sequencing primer GCTTCCTTTCGGGCTTTGTTAGCAGCCGGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GreenT-EC.c - pRSET was a gift from Oliver Griesbeck (Addgene plasmid # 193949 ; http://n2t.net/addgene:193949 ; RRID:Addgene_193949) -
For your References section:
Fluorescent sensors for imaging of interstitial calcium. Valiente-Gabioud AA, Garteizgogeascoa Suner I, Idziak A, Fabritius A, Basquin J, Angibaud J, Nagerl UV, Singh SP, Griesbeck O. Nat Commun. 2023 Oct 5;14(1):6220. doi: 10.1038/s41467-023-41928-w. 10.1038/s41467-023-41928-w PubMed 37798285