pAAV-EF1a-CCre-MBP4-WPRE
(Plasmid
#193919)
-
PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV vector
-
Backbone manufacturerBackbone vector is derived from pAAV-EF1a-C-CreintG (Connie Cepko, Addgene #69571)
- Backbone size w/o insert (bp) 5338
- Total vector size (bp) 6769
-
Vector typeMammalian Expression, AAV, Cre/Lox, Synthetic Biology, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCCre-MBP4
-
SpeciesSynthetic
-
Insert Size (bp)1431
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer gcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone vector is derived from pAAV-EF1a-C-CreintG (Connie Cepko, Addgene #69571) and amino acid sequence of MBP is derived from (Fridy, 2014-Nat Methods).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-CCre-MBP4-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 193919 ; http://n2t.net/addgene:193919 ; RRID:Addgene_193919) -
For your References section:
Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals. Inutsuka A, Maejima S, Mizoguchi H, Kaneko R, Nomura R, Takanami K, Sakamoto H, Onaka T. Commun Biol. 2022 Sep 16;5(1):979. doi: 10.1038/s42003-022-03944-2. 10.1038/s42003-022-03944-2 PubMed 36114373