pAAV-EF1a-NCre-MBP5-WPRE
(Plasmid #193918)

• Purpose: Expresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)
• Depositing Lab: Tatsushi Onaka
• Publication: Inutsuka et al Commun Biol. 2022 Sep 16;5(1):979. doi: 10.1038/s42003-022-03944-2.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV vector
• Backbone manufacturer: Backbone vector is derived from pAAV-EF1a-N-CretrcintG (Connie Cepko, Addgene #69570)
• Backbone size w/o insert (bp): 5338
• Total vector size (bp): 6064
• Vector type: Mammalian Expression, AAV, Cre/Lox, Synthetic Biology, Affinity Reagent/ Antibody

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NCre-MBP5
• Species: Synthetic
• Insert Size (bp): 726
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: gcgtaaaaggagcaacatag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone vector is derived from pAAV-EF1a-N-CretrcintG (Connie Cepko, Addgene #69570) and amino acid sequence of MBP is derived from (Fridy, 2014-Nat Methods).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry