Skip to main content
Addgene

pAAV-EF1a-CCre-MBP1-WPRE
(Plasmid #193917)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193917 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV vector
  • Backbone manufacturer
    Backbone vector is derived from pAAV-EF1a-C-CreintG (Connie Cepko, Addgene #69571)
  • Backbone size w/o insert (bp) 5338
  • Total vector size (bp) 6778
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology, Affinity Reagent/ Antibody

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CCre-MBP1
  • Species
    Synthetic
  • Insert Size (bp)
    1440
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer gcgtaaaaggagcaacatag
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone vector is derived from pAAV-EF1a-C-CreintG (Connie Cepko, Addgene #69571) and amino acid sequence of MBP is derived from (Fridy, 2014-Nat Methods).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-CCre-MBP1-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 193917 ; http://n2t.net/addgene:193917 ; RRID:Addgene_193917)

  • For your References section:

    Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals. Inutsuka A, Maejima S, Mizoguchi H, Kaneko R, Nomura R, Takanami K, Sakamoto H, Onaka T. Commun Biol. 2022 Sep 16;5(1):979. doi: 10.1038/s42003-022-03944-2. 10.1038/s42003-022-03944-2 PubMed 36114373
Related items:
Commonly requested with: