pAAV-hSyn-mCherry-T2A-miniSOG-C-Far
(Plasmid #193915)

• Purpose: Expresses miniSOG targeted to the plasma membrane of neurons, joined by a T2A cleavage site with mCherry; for AAV production
• Depositing Lab: Xiao Wang
• Publication: Sessler et al Sci Adv. 2022 Dec 9;8(49):eade1136. doi: 10.1126/sciadv.ade1136. Epub 2022 Dec 7.

Backbone

• Vector backbone: pAAV-hSyn
• Backbone manufacturer: Addgene 50970
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 5800
• Modifications to backbone: None
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: miniSOG
• Species: Synthetic
• Insert Size (bp): 318
• Promoter: hSyn
• Tags / Fusion Proteins:
  • Flag tag (N terminal on insert)
  • Farnesylation signal sequence (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagtcgtgtcgtgcctgag
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • CDS-G032_pAAV-hSyn-mCherry-T2A-FLAG-miniSOG-C-Far.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene 50970

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry