1BR9-mCherrySTOP
(Plasmid #193866)

• Purpose: E. coli expression vector for N-ter GFP11 tagged mCherry.
• Depositing Lab: Markita Landry
• Publication: Wang et al Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5.

Backbone

• Vector backbone: 1BR9
• Backbone size w/o insert (bp): 5513
• Total vector size (bp): 6227
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Discosoma sp.
• Insert Size (bp): 705
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • GFP11 (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • 1br9-mcherrystop.gb
• A portion of this plasmid was derived from a plasmid made by: mCherry sequence cloned from Addgene: Plasmid #29722

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains stop codon before C-ter tag to generate untagged protein.