1BR9
(Plasmid
#193862)
-
Purpose(Empty Backbone) E. coli expression vector for N-ter GFP11 and C-ter R9 tagged proteins. Empty backbone for LIC cloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbone1B
- Backbone size (bp) 5513
-
Modifications to backboneDerived from LIC vector 1B (Addgene Plasmid #29653) with N-Ter HIsxG and C-ter R9.
-
Vector typeBacterial Expression
-
Tags
/ Fusion Proteins
- Hisx6 (N terminal on backbone)
- GFP11 (N terminal on backbone)
- R9 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene Plasmid #29653.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Add LIC fusion tags to the 5' end of your PCR primers for insert generation.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1BR9 was a gift from Markita Landry (Addgene plasmid # 193862 ; http://n2t.net/addgene:193862 ; RRID:Addgene_193862) -
For your References section:
Delivered complementation in planta (DCIP) enables measurement of peptide-mediated protein delivery efficiency in plants. Wang JW, Squire HJ, Goh NS, Ni HM, Lien E, Wong C, Gonzalez-Grandio E, Landry MP. Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5. 10.1038/s42003-023-05191-5 PubMed 37573467