DCIP
(Plasmid #193860)

• Purpose: Encodes SV40-mCherry-GFP1-10 in pDGB1-aR backbone for plant expression. Requires pSOUP for replication in agrobacterium.
• Depositing Lab: Markita Landry
• Publication: Wang et al Commun Biol. 2023 Aug 12;6(1):840. doi: 10.1038/s42003-023-05191-5.

Backbone

• Vector backbone: pDGB1-a1r
• Backbone size w/o insert (bp): 3196
• Total vector size (bp): 4957
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-mCherry-GFP1-10
• Species: Synthetic
• Insert Size (bp): 1416
• Promoter: 35S
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: gggaaacgcctggtatcttt
• 3′ sequencing primer: CCGATCCCCGGAATTAGATC

Resource Information

• Supplemental Documents:
  • copy-of-pdgb1-a1r-35s-dcip-tnos.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Nuclear localized expression of mCherry-GFP1-10 in plants. Transcriptional unit in GoldenBraid pDGB1 alpha1R. Insert can be excised by Esp3I digestion. Requires pSOUP for replication in agrobacterium