pLenti-dCas9-T2A-GFP
(Plasmid #193781)

• Purpose: Tricistronic expression of dCas9-EGFP-BSD
• Depositing Lab: James Eshleman
• Publication: Targeting somatic PAMs by CRISPR/Cas9 causes delayed cancer cell death (unpublished)

Backbone

• Vector backbone: pLentiCas9-T2A-GFP
• Backbone manufacturer: Addgene #78548
• Backbone size w/o insert (bp): 9581
• Total vector size (bp): 13669
• Modifications to backbone: Replace Cas9 with dCas9
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dead Cas9
• Alt name: dCas9
• Species: Synthetic
• Insert Size (bp): 4233
• Promoter: In frame with existing Cas9 promoter
• Tag / Fusion Protein:
  • FLAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaacgttctttttcgcaacgggtttgccgccagaacacaggaccggtgccgcccaccatg
• 3′ sequencing primer: gtcgcctcccagctgagacaggtcgatccgtgtctcgtacaggccggtgatgctctggtg

Resource Information

• Supplemental Documents:
  • pLenti-dCas9-T2A-GFP.gbk
• A portion of this plasmid was derived from a plasmid made by: pZLCv2-3xFLAG-dCas9-HA-2xNLS (Addgene #106357)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.03.535384 for bioRxiv preprint.