pLentiCas9-T2A-mApple
(Plasmid #193780)

• Purpose: Tricistronic expression of Cas9-mApple-BSD in mammalian cells
• Depositing Lab: James Eshleman
• Publication: Targeting somatic PAMs by CRISPR/Cas9 causes delayed cancer cell death (unpublished)

Backbone

• Vector backbone: pLentiCas9-T2A-GFP
• Backbone manufacturer: Addgene #78548
• Backbone size w/o insert (bp): 13014
• Total vector size (bp): 13669
• Modifications to backbone: Replace EGFP with mApple
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mApple
• Species: Synthetic
• Insert Size (bp): 686
• Promoter: In frame with Cas9

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gggcgaggagaataacatggccatcatcaaggagttcatg
• 3′ sequencing primer: cgtccatgccgccggtggagtggcggccctcggcgcgttc

Resource Information

• Supplemental Documents:
  • pLentiCas9-T2A-mApple.gbk
• A portion of this plasmid was derived from a plasmid made by: mApple-N1 (Addgene #54567)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.03.535384 for bioRxiv preprint.