pLV-TetOn-Cdt1-mCherry
(Plasmid #193760)

• Purpose: Doxycyline-inducible (TetOn) human Cdt1 (C-terminal mCherry tag)
• Depositing Lab: Tobias Meyer
• Publication: Ratnayeke et al Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004.

Backbone

• Vector backbone: pLV-TetOn
• Backbone size w/o insert (bp): 6532
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cdt1-mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 2385
• Mutation: WT
• Entrez Gene: CDT1 (a.k.a. DUP, RIS2)
• Promoter: TRE
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagagctcgtttagtgaaccg
• 3′ sequencing primer: cattaaagcagcgtatcc

Resource Information

• Supplemental Documents:
  • pLV-TetOn-Cdt1-mCherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.