pLV-mCherry-hCdt1(1-100)ΔCy
(Plasmid
#193759)
-
PurposeExpresses N-CRL4Cdt2 reporter(mCherry-hCdt1(1-100)ΔCy)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-EF1a
- Backbone size w/o insert (bp) 7482
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-hCdt1(1-100)ΔCy
-
Alt nameN-CRL4Cdt2 reporter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1050
-
Mutationhuman Cdt1 amino acids 1-100 w/ ΔCy mutation (aa68-70 to alanine)
-
Entrez GeneCDT1 (a.k.a. DUP, RIS2)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcaagcctcagacagtggttc
- 3′ sequencing primer cattaaagcagcgtatcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-mCherry-hCdt1(1-100)ΔCy was a gift from Tobias Meyer (Addgene plasmid # 193759 ; http://n2t.net/addgene:193759 ; RRID:Addgene_193759) -
For your References section:
CDT1 inhibits CMG helicase in early S phase to separate origin licensing from DNA synthesis. Ratnayeke N, Baris Y, Chung M, Yeeles JTP, Meyer T. Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004. 10.1016/j.molcel.2022.12.004 PubMed 36608667