Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJA2LUXR(F)
(Plasmid #193755)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193755 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZ
  • Backbone size w/o insert (bp) 2345
  • Total vector size (bp) 3144
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LuxR
  • Species
    Bacteria
  • Insert Size (bp)
    799
  • Promoter BBa_J23102

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ATGCCGACGACACATACAGA
  • 3′ sequencing primer TGATGCCTGGCTCTAGTAGTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJA2LUXR(F) was a gift from Sangram Bagh (Addgene plasmid # 193755 ; http://n2t.net/addgene:193755 ; RRID:Addgene_193755)
  • For your References section:

    A single layer artificial neural network type architecture with molecular engineered bacteria for reversible and irreversible computing. Sarkar K, Bonnerjee D, Srivastava R, Bagh S. Chem Sci. 2021 Nov 9;12(48):15821-15832. doi: 10.1039/d1sc01505b. eCollection 2021 Dec 15. 10.1039/d1sc01505b PubMed 35024106