pX*C3E2-Crimson
(Plasmid
#193754)
-
PurposeExpresses E2-Crimson under the control of PLUX* promoter, p15A origin of replication, Chloramphenicol selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZ
- Backbone size w/o insert (bp) 1990
- Total vector size (bp) 2668
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameE2-Crimson
-
SpeciesBacteria
-
Insert Size (bp)678
- Promoter PLUX*
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer TGGATAGCACTGAGAACGTCAT
- 3′ sequencing primer ACCACGGTGTAGTCCTCGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX*C3E2-Crimson was a gift from Sangram Bagh (Addgene plasmid # 193754 ; http://n2t.net/addgene:193754 ; RRID:Addgene_193754) -
For your References section:
A single layer artificial neural network type architecture with molecular engineered bacteria for reversible and irreversible computing. Sarkar K, Bonnerjee D, Srivastava R, Bagh S. Chem Sci. 2021 Nov 9;12(48):15821-15832. doi: 10.1039/d1sc01505b. eCollection 2021 Dec 15. 10.1039/d1sc01505b PubMed 35024106