pSmart-Kan-HC-EF1a-Nla-Cas8-7-5-11
(Plasmid
#193752)
-
Purposehuman codon optimized Nla-cas8c-Cas7c-Cas5c-Cas11c cloned into pSmart-HC-Kan-EF1a-bGH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSmart HC Kan
-
Backbone manufacturerLucigen
- Backbone size w/o insert (bp) 1993
- Total vector size (bp) 7288
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-NlaCas8c-Cas7c-Cas5c-Cas11c-bGH PolyA
-
SpeciesSynthetic
-
Insert Size (bp)5295
-
GenBank IDn/a
- Promoter EF1a
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttgccctttttgagtttgg
- 3′ sequencing primer CAGTCCAGTTACGCTGGAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSmart-Kan-HC-EF1a-Nla-Cas8-7-5-11 was a gift from Yan Zhang (Addgene plasmid # 193752 ; http://n2t.net/addgene:193752 ; RRID:Addgene_193752) -
For your References section:
Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351