Addgene: pTP-AAV-ChATen-mCherry Skip to main content
Addgene

pTP-AAV-ChATen-mCherry
(Plasmid #193741)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193741 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV from Addgene Plasmid #37825
  • Backbone size w/o insert (bp) 3777
  • Total vector size (bp) 5683
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChAT enhancer, mini promoter, synthetic intron, mCherry
  • Species
    M. musculus (mouse), Synthetic; Mouse
  • Insert Size (bp)
    1906
  • Promoter 1000 bp ChAT enhancer with a 32 bp minimal promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgtagccatgctctaggaag
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

By replacing mCherry with gene of interest, this vector can be used for AAV-based delivery specifically into skeletal motor neurons in the spinal cord. The specificity of expression has not been characterized outside the spinal cord.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTP-AAV-ChATen-mCherry was a gift from Hynek Wichterle (Addgene plasmid # 193741 ; http://n2t.net/addgene:193741 ; RRID:Addgene_193741)