pTP-AAV-ChATen-mCherry
(Plasmid #193741)

• Purpose: This AAV vector contains a ChAT enhancer that drives mCherry expression in spinal cord skeletal motor neurons. Specificity of vector not characterized outside the mouse spinal cord.
• Depositing Lab: Hynek Wichterle
• Publication: AAV vector for gene delivery to spinal cord skeletal motor neurons (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV from Addgene Plasmid #37825
• Backbone size w/o insert (bp): 3777
• Total vector size (bp): 5683
• Vector type: Mammalian Expression, Mouse Targeting, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ChAT enhancer, mini promoter, synthetic intron, mCherry
• Species: M. musculus (mouse), Synthetic; Mouse
• Insert Size (bp): 1906
• Promoter: 1000 bp ChAT enhancer with a 32 bp minimal promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acgtagccatgctctaggaag
• 3′ sequencing primer: catagcgtaaaaggagcaaca

Resource Information

• Supplemental Documents:
  • pTP-AAV-ChATen-mCherry.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

By replacing mCherry with gene of interest, this vector can be used for AAV-based delivery specifically into skeletal motor neurons in the spinal cord. The specificity of expression has not been characterized outside the spinal cord.