pLKO.1 puro shPRDM14-1
(Plasmid
#193694)
-
PurposeConstitutive lentiviral expression of PRDM14 shRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRDM14
-
gRNA/shRNA sequenceCCGGCGTCCTATGGACACTACAGAACTCGAGTTCTGTAGTGTCCATAGGACGTTTTT
-
SpeciesH. sapiens (human)
-
Entrez GenePRDM14 (a.k.a. PFM11)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBroad Institute (GPP)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Clone ID: TRCN0000018523
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 puro shPRDM14-1 was a gift from William Hahn (Addgene plasmid # 193694 ; http://n2t.net/addgene:193694 ; RRID:Addgene_193694) -
For your References section:
YAP1 and PRDM14 converge to promote cell survival and tumorigenesis. Kim M, Ly SH, Xie Y, Duronio GN, Ford-Roshon D, Hwang JH, Sulahian R, Rennhack JP, So J, Gjoerup O, Talamas JA, Grandclaudon M, Long HW, Doench JG, Sethi NS, Giannakis M, Hahn WC. Dev Cell. 2022 Jan 24;57(2):212-227.e8. doi: 10.1016/j.devcel.2021.12.006. Epub 2022 Jan 5. 10.1016/j.devcel.2021.12.006 PubMed 34990589