Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-Tet-On shYAP1-9
(Plasmid #193668)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO-Tet-On
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP1
  • gRNA/shRNA sequence
    GCAATCACTGTGTTGTATATA
  • Species
    H. sapiens (human)
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On shYAP1-9 was a gift from William Hahn (Addgene plasmid # 193668 ; http://n2t.net/addgene:193668 ; RRID:Addgene_193668)
  • For your References section:

    YAP1 and PRDM14 converge to promote cell survival and tumorigenesis. Kim M, Ly SH, Xie Y, Duronio GN, Ford-Roshon D, Hwang JH, Sulahian R, Rennhack JP, So J, Gjoerup O, Talamas JA, Grandclaudon M, Long HW, Doench JG, Sethi NS, Giannakis M, Hahn WC. Dev Cell. 2022 Jan 24;57(2):212-227.e8. doi: 10.1016/j.devcel.2021.12.006. Epub 2022 Jan 5. 10.1016/j.devcel.2021.12.006 PubMed 34990589