Skip to main content
Addgene

H1.99.M.luc
(Plasmid #193664)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193664 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Basic vector
  • Backbone manufacturer
    promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated Pol III H1 promoter with a mutated TATA box (H1.99m) + N41
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H1.99.M.luc was a gift from Elena Herrera-Carrillo (Addgene plasmid # 193664 ; http://n2t.net/addgene:193664 ; RRID:Addgene_193664)

  • For your References section:

    Engineered mini H1 promoters with dedicated RNA Polymerase II or III activity. Gao Z, van der Velden YU, Fan M, van der Linden CA, Vink M, Herrera-Carrillo E, Berkhout B. J Biol Chem. 2020 Nov 5. pii: S0021-9258(20)00012-5. doi: 10.1074/jbc.RA120.015386. 10.1074/jbc.RA120.015386 PubMed 33154168
Related items: