U6-sgRNA-hcr3
(Plasmid
#193660)
-
PurposeExpression of tandem pre-sgRNA array hcr3 for LbCas12a
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-CFTR-sgRNA-KLF4-sgRNA-TET1-sgRNA-tRNA
-
gRNA/shRNA sequenceCTGACTGCTCACTAGATGTTGAA; GTTTAAACACACCGGGTTAATA; CTAGGACCAGCCTGAGAGAGTTG
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13 rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-sgRNA-hcr3 was a gift from Liangxue Lai (Addgene plasmid # 193660 ; http://n2t.net/addgene:193660 ; RRID:Addgene_193660) -
For your References section:
Multiplexed base editing through Cas12a variant-mediated cytosine and adenine base editors. Chen F, Lian M, Ma B, Gou S, Luo X, Yang K, Shi H, Xie J, Ge W, Ouyang Z, Lai C, Li N, Zhang Q, Jin Q, Liang Y, Chen T, Wang J, Zhao X, Li L, Yu M, Ye Y, Wang K, Wu H, Lai L. Commun Biol. 2022 Nov 2;5(1):1163. doi: 10.1038/s42003-022-04152-8. 10.1038/s42003-022-04152-8 PubMed 36323848