Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR_003 sgNFkB2 guide 1
(Plasmid #193593)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193593 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXPR_003
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgNFkB2 guide 1
  • gRNA/shRNA sequence
    GGGACCAGCCAAGATCGAGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    NFKB2 (a.k.a. CVID10, H2TF1, LYT-10, LYT10, NF-kB2, p100, p49/p100, p52)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_003 sgNFkB2 guide 1 was a gift from William Hahn (Addgene plasmid # 193593 ; http://n2t.net/addgene:193593 ; RRID:Addgene_193593)
  • For your References section:

    Systematic interrogation of tumor cell resistance to CAR T cell therapy in pancreatic cancer. Hagel KR, Arafeh R, Gang S, Arnoff TE, Larson RC, Doench JG, Mathewson ND, Wucherpfennig KW, Maus MV, Hahn WC. Cancer Res. 2022 Dec 22:CAN-22-2245. doi: 10.1158/0008-5472.CAN-22-2245. 10.1158/0008-5472.CAN-22-2245 PubMed 36548402