pXPR_003_sgTFAP4 guide 2
(Plasmid
#193587)
-
PurposeTFAP4 knockout
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_003
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTFAP4 guide 2
-
gRNA/shRNA sequenceCGCATGCAGAGCATCAACGC
-
SpeciesH. sapiens (human)
-
Entrez GeneTFAP4 (a.k.a. AP-4, bHLHc41)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_003_sgTFAP4 guide 2 was a gift from William Hahn (Addgene plasmid # 193587 ; http://n2t.net/addgene:193587 ; RRID:Addgene_193587) -
For your References section:
Systematic interrogation of tumor cell resistance to CAR T cell therapy in pancreatic cancer. Hagel KR, Arafeh R, Gang S, Arnoff TE, Larson RC, Doench JG, Mathewson ND, Wucherpfennig KW, Maus MV, Hahn WC. Cancer Res. 2022 Dec 22:CAN-22-2245. doi: 10.1158/0008-5472.CAN-22-2245. 10.1158/0008-5472.CAN-22-2245 PubMed 36548402