LYSO-LRRK2
(Plasmid
#193582)
-
PurposeExpresses human full-length LRRK2 with a lysosomal targeting sequence from LAMTOR1 (1-39aa) and 3xFLAG on the N-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST
- Backbone size w/o insert (bp) 5060
- Total vector size (bp) 12512
-
Modifications to backboneLAMTOR1(1-39aa) and 3xFLAG sequences
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLeucine-rich repeat kinase 2
-
Alt nameLRRK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7584
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
- Promoter CMV
-
Tag
/ Fusion Protein
- LAMTOR1(1-39aa) and 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCTAGTGGCAGCTGTCAGGGGTGCGAAGAGGACGAGGAAACTCTGAAG
- 3′ sequencing primer AAAAATGAGACGAACATCTGTTGAGTAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LYSO-LRRK2 was a gift from Mark Cookson (Addgene plasmid # 193582 ; http://n2t.net/addgene:193582 ; RRID:Addgene_193582) -
For your References section:
Lysosomal positioning regulates Rab10 phosphorylation at LRRK2(+) lysosomes. Kluss JH, Beilina A, Williamson CD, Lewis PA, Cookson MR, Bonet-Ponce L. Proc Natl Acad Sci U S A. 2022 Oct 25;119(43):e2205492119. doi: 10.1073/pnas.2205492119. Epub 2022 Oct 18. 10.1073/pnas.2205492119 PubMed 36256825