vHB66
(Plasmid
#193456)
-
Purpose(Empty Backbone) Vector for expression of second copy genes in pandoravirus/mollivirus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonevHB63
-
Vector typePandoravirus/mollivirus Expression
- Promoter pneo650
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTTGCAAAAAGCTtCGGCTCTGCAGTTGATCTC
- 3′ sequencing primer CAGAAGAATCAAGCTGATGATGGTTGCGGTTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vHB66 was a gift from Chantal Abergel (Addgene plasmid # 193456 ; http://n2t.net/addgene:193456 ; RRID:Addgene_193456) -
For your References section:
Evolution of giant pandoravirus revealed by CRISPR/Cas9. Bisio H, Legendre M, Giry C, Philippe N, Alempic JM, Jeudy S, Abergel C. Nat Commun. 2023 Jan 26;14(1):428. doi: 10.1038/s41467-023-36145-4. 10.1038/s41467-023-36145-4 PubMed 36702819