mGFP-hNET
(Plasmid #193364)

• Purpose: expression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cells
• Depositing Lab: Harald Sitte
• Publication: Luethi et al Commun Biol. 2022 Nov 17;5(1):1259. doi: 10.1038/s42003-022-04210-1.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6600
• Modifications to backbone: eGFP A206K mutation resulting in mGFP
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Norepinephrine Transporter
• Alt name: NET, NAT, SLC6A2
• Species: H. sapiens (human)
• Insert Size (bp): 1850
• Entrez Gene: SLC6A2 (a.k.a. NAT1, NET, NET1, SLC6A5)
• Promoter: CMV
• Tag / Fusion Protein:
  • monomeric GFP (mGFP) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: EGFP-C1-fw: GAAGCGCGATCACATGGTC
• 3′ sequencing primer: EGFP-C1-rv: AACCATTATAAGCTGCAATAAAC

Resource Information

• Supplemental Documents:
  • mGFP-hNET.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry