vgCam-pRSETb
(Plasmid
#193362)
-
PurposeA FRET-based calcium probe using Sumire
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193362 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSETB
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 4900
-
Vector typeE.coli expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevgCam
-
Alt namevgCam
-
SpeciesE.coli
-
Insert Size (bp)2000
- Promoter T7
-
Tags
/ Fusion Proteins
- His X6 tag (N terminal on insert)
- Strep tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGATCCCGCGAAATTAATACGAC
- 3′ sequencing primer GCCTCTTCGCTATTACGCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vgCam-pRSETb was a gift from Takeharu Nagai (Addgene plasmid # 193362 ; http://n2t.net/addgene:193362 ; RRID:Addgene_193362) -
For your References section:
Extension of the short wavelength side of fluorescent proteins using hydrated chromophores, and its application. Sugiura K, Nagai T. Commun Biol. 2022 Nov 3;5(1):1172. doi: 10.1038/s42003-022-04153-7. 10.1038/s42003-022-04153-7 PubMed 36329112