Skip to main content
Addgene

T7-VEE-OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1
(Plasmid #193356)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 193356 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    T7-VEE-IRES-puro (Addgene plasmid 58970)
  • Backbone size w/o insert (bp) 13244
  • Total vector size (bp) 17069
  • Vector type
    Mammalian Expression ; Venezuelan equine encephalitis (VEE) virus RNA replicon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1
  • Alt name
    superSOX
  • Alt name
    S*
  • Alt name
    POU5F1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3826
  • Mutation
    SOX2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of SOX2 were swapped with SOX17: 43-47, 61, 65-86 and CTD
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer CGGCTAACCTGAATGGACTACGAC
  • 3′ sequencing primer TATAGACAAACGCACACCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T7-VEE-OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1 was a gift from Hans Schöler (Addgene plasmid # 193356 ; http://n2t.net/addgene:193356 ; RRID:Addgene_193356)

  • For your References section:

    Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611
Related items:
Commonly requested with: