Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBS-TRE-mTagBFP2-WPRE
(Plasmid #193332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193332 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript SK(+)
  • Backbone manufacturer
    Stratagene
  • Total vector size (bp) 4747
  • Modifications to backbone
    An Xho-Xho fragment containing TRE-SV40 poly A was transferred from pTRE-Tight (Clontech). WPRE was also inserted between a NotI site (not destroyed)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTagBFP2
  • Species
    Modified fluorescent protein
  • Insert Size (bp)
    714
  • Mutation
    A XhoI site in the coding sequence is silenced
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ATGTCGAGGTAGGCGTGTAC
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    TagBFP gene was purchased from Evrogen

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS-TRE-mTagBFP2-WPRE was a gift from Takeshi Imai (Addgene plasmid # 193332 ; http://n2t.net/addgene:193332 ; RRID:Addgene_193332)
  • For your References section:

    Automated neuronal reconstruction with super-multicolour Tetbow labelling and threshold-based clustering of colour hues. Leiwe MN, Fujimoto S, Baba T, Moriyasu D, Saha B, Sakaguchi R, Inagaki S, Imai T. Nat Commun. 2024 Jun 25;15(1):5279. doi: 10.1038/s41467-024-49455-y. 10.1038/s41467-024-49455-y PubMed 38918382
Commonly requested with: