pBS-TRE-mTagBFP2-WPRE
(Plasmid #193332)

• Purpose: Expresses mTagBFP2 under the TRE promoter in mammalian cells
• Depositing Lab: Takeshi Imai
• Publication: Leiwe et al Nat Commun. 2024 Jun 25;15(1):5279. doi: 10.1038/s41467-024-49455-y.

Backbone

• Vector backbone: pBluescript SK(+)
• Backbone manufacturer: Stratagene
• Total vector size (bp): 4747
• Modifications to backbone: An Xho-Xho fragment containing TRE-SV40 poly A was transferred from pTRE-Tight (Clontech). WPRE was also inserted between a NotI site (not destroyed)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mTagBFP2
• Species: Modified fluorescent protein
• Insert Size (bp): 714
• Mutation: A XhoI site in the coding sequence is silenced
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: ATGTCGAGGTAGGCGTGTAC
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • pBS-TRE-mTagBFP2-WPRE.gb
• A portion of this plasmid was derived from a plasmid made by: TagBFP gene was purchased from Evrogen

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.