pCZGY2727
(Plasmid #193330)

• Purpose: Site specific insertion using CRISPR/Cas9 editing of C. elegans ChrI
• Depositing Lab: Yishi Jin
• Publication: Blazie et al Elife. 2021 Jul 29;10. pii: 68336. doi: 10.7554/eLife.68336.

Backbone

• Vector backbone: pCFJ210
• Backbone manufacturer: Erik Jorgensen Lab
• Backbone size w/o insert (bp): 7539
• Total vector size (bp): 12343
• Modifications to backbone: Replacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hygromycin resistance
• Insert Size (bp): 4804
• Promoter: Prps-0

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tgtcgaccgctagtgtagcttac
• 3′ sequencing primer: AGCCAGTCTGCAGGTCGACC

Resource Information

• Supplemental Documents:
  • pCZGY2727.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry