pELPS-eDHFR-YFP-T2A-Renilla
(Plasmid
#193253)
-
PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepELPS
- Backbone size w/o insert (bp) 6770
- Total vector size (bp) 8975
-
Modifications to backboneBamHI and SalI for inserts.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsLB or TB for growth
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
-
Alt nameeDHFR-YFP-T2A-Renilla
-
Speciesthe Escherichia coli
-
Insert Size (bp)2205
-
MutationNone
-
GenBank IDWP_000624375.1
- Promoter EF1a
-
Tags
/ Fusion Proteins
- yellow fluorescent protein (YFP) (C terminal on insert)
- Renilla luciferase (rLuc) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTTGGTTCATTCTCAAGCCTCAGAC
- 3′ sequencing primer GCAATAGCATGATACAAAGGCATTAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pELPS-eDHFR-YFP-T2A-Renilla was a gift from Mark Sellmyer (Addgene plasmid # 193253 ; http://n2t.net/addgene:193253 ; RRID:Addgene_193253) -
For your References section:
Imaging CAR T Cell Trafficking with eDHFR as a PET Reporter Gene. Sellmyer MA, Richman SA, Lohith K, Hou C, Weng CC, Mach RH, O'Connor RS, Milone MC, Farwell MD. Mol Ther. 2020 Jan 8;28(1):42-51. doi: 10.1016/j.ymthe.2019.10.007. Epub 2019 Oct 15. 10.1016/j.ymthe.2019.10.007 PubMed 31668558