pCW-tTRE-scFv-SunTag
(Plasmid
#193138)
-
PurposeExpresses scFv intracellular antibody component of the SunTag system under Dox regulation
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCW-tTRE
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescFv-SunTag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1998
- Promoter tight TRE promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (destroyed during cloning)
- 3′ cloning site BamHi (destroyed during cloning)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GACCCAGGGTCGGCGCCGCTG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-tTRE-scFv-SunTag was a gift from Brad Rosenberg (Addgene plasmid # 193138 ; http://n2t.net/addgene:193138 ; RRID:Addgene_193138) -
For your References section:
Inducible CRISPR activation screen for interferon-stimulated genes identifies OAS1 as a SARS-CoV-2 restriction factor. Danziger O, Patel RS, DeGrace EJ, Rosen MR, Rosenberg BR. PLoS Pathog. 2022 Apr 14;18(4):e1010464. doi: 10.1371/journal.ppat.1010464. eCollection 2022 Apr. 10.1371/journal.ppat.1010464 PubMed 35421191